Journal: The Journal of Infectious Diseases

Article Title: Assessment and Optimization of the GeneXpert Diagnostic Platform for Detection of Ebola Virus RNA in Seminal Fluid

doi: 10.1093/infdis/jiw599

Figure Lengend Snippet: Comparison of Detection of EBOV in Spiked Semen Samples Using Modified Xpert EBOV Assay or Existing MGB and EZ-1 Assays

Article Snippet: Qiagen buffer AVL RNA extraction protocols, as well as the Ebola Zaire Target 1 (EZ1) and major groove binder (MGB) real-time–polymerase chain reaction (RT-PCR) assays were demonstrated to be suitable for testing semen samples when performance was compared to blood samples [ 10 ].

Techniques: Comparison, Modification, Concentration Assay

Journal: The Journal of Infectious Diseases

Article Title: Assessment and Optimization of the GeneXpert Diagnostic Platform for Detection of Ebola Virus RNA in Seminal Fluid

doi: 10.1093/infdis/jiw599

Figure Lengend Snippet: Field Evaluation of Semen Samples From EBOV Survivors Using Modified Xpert Ebola, MGB, and EZ1 Assays

Article Snippet: Qiagen buffer AVL RNA extraction protocols, as well as the Ebola Zaire Target 1 (EZ1) and major groove binder (MGB) real-time–polymerase chain reaction (RT-PCR) assays were demonstrated to be suitable for testing semen samples when performance was compared to blood samples [ 10 ].

Techniques: Modification

Journal: Experimental and Therapeutic Medicine

Article Title: Expression and significance of NELIN and SM22α in varicose vein tissue

doi: 10.3892/etm.2015.2170

Figure Lengend Snippet: Primer sequences used for reverse transcription polymerase chain reaction analysis of NELIN.

Article Snippet: TransZol Up and two-step reverse transcription polymerase chain reaction (RT-PCR) kits were purchased from Beijing TransGen Biotech Co., Ltd. (Beijing, China). β-actin upstream and downstream primers were synthesized by Takara Bio, Inc. (Shiga, Japan).

Techniques: Reverse Transcription Polymerase Chain Reaction, Amplification

Journal: Experimental and Therapeutic Medicine

Article Title: Expression and significance of NELIN and SM22α in varicose vein tissue

doi: 10.3892/etm.2015.2170

Figure Lengend Snippet: Primer sequences used for reverse transcription polymerase chain reaction analysis of SM22α.

Article Snippet: TransZol Up and two-step reverse transcription polymerase chain reaction (RT-PCR) kits were purchased from Beijing TransGen Biotech Co., Ltd. (Beijing, China). β-actin upstream and downstream primers were synthesized by Takara Bio, Inc. (Shiga, Japan).

Techniques: Reverse Transcription Polymerase Chain Reaction, Amplification

Journal: Experimental and Therapeutic Medicine

Article Title: Expression and significance of NELIN and SM22α in varicose vein tissue

doi: 10.3892/etm.2015.2170

Figure Lengend Snippet: Reverse transcription polymerase chain reaction analysis revealed weak mRNA expression of NELIN in the vascular smooth muscle cells (VSMCs) of the experimental group, but strong expression in the control group. (A) Expected length of the PCR products was 611 bp (NELIN) and 312 bp (β-actin). Lanes: N, control group; X, DNA marker DL 2000; and P, experimental group. (B) Downregulation of NELIN mRNA expression in the VSMCs from the varicose vein tissue. Data are presented as the mean ± standard deviation.

Article Snippet: TransZol Up and two-step reverse transcription polymerase chain reaction (RT-PCR) kits were purchased from Beijing TransGen Biotech Co., Ltd. (Beijing, China). β-actin upstream and downstream primers were synthesized by Takara Bio, Inc. (Shiga, Japan).

Techniques: Reverse Transcription Polymerase Chain Reaction, Expressing, Marker, Standard Deviation

Journal: Experimental and Therapeutic Medicine

Article Title: Expression and significance of NELIN and SM22α in varicose vein tissue

doi: 10.3892/etm.2015.2170

Figure Lengend Snippet: Reverse transcription polymerase chain reaction analysis revealed weak mRNA expression of SM22α in the vascular smooth muscle cells (VSMCs) of the experimental group, but strong expression in the control group. (A) Expected length of the PCR products was 232 bp (SM22α) and 472 bp (GADPH). Lanes: N, control group; X, DNA marker DL 2000; and P, experimental group. (B) Downregulation of SM22α mRNA expression in the VSMCs from the varicose vein tissue. Data are presented as the mean ± standard deviation.

Article Snippet: TransZol Up and two-step reverse transcription polymerase chain reaction (RT-PCR) kits were purchased from Beijing TransGen Biotech Co., Ltd. (Beijing, China). β-actin upstream and downstream primers were synthesized by Takara Bio, Inc. (Shiga, Japan).

Techniques: Reverse Transcription Polymerase Chain Reaction, Expressing, Marker, Standard Deviation

Journal: Aging (Albany NY)

Article Title: ER-depletion lowering the 'hypothalamus-uterus-kidney' axis functions by perturbing the renal ERβ/Ptgds signalling pathway

doi: 10.18632/aging.102401

Figure Lengend Snippet: Correlation analyses illustrated the relationships among ‘genes-metabolites-phenotypes’ in ER-depletion-induced renal lipid metabolism disorder. ( A ) Relative peptide quantification in control and OVX rat urine samples. n=3, mean ± s.e.m.; ( B ) Real time PCR assays of uterus ERβ among control, OVX and OVX+E2 rats. n=3, mean ± s.e.m.; ( C ) Average weekly body weight (g) from 0 to 12 weeks before and after surgery and average organ/body weight ratio (organ %) at 12 weeks after surgery. ( D ) Kidney biochemical profiles in the sera of control and OVX rats. ( E ) Lipid biochemical profiles in the sera of control and OVX rats. n=6, mean ± s.d., compared to control rats, *p ˂ 0.05, **p ˂ 0.005, ***p ˂ 0.0005. Correlation heat map representation of the differentially expressed gene and metabolite markers in organs, renal biochemistry, and lipid biochemistry phenotypes including genes clustered into organ phenotypes, subsets of genes clustered into organ functions and subsets of genes clustered into eicosanoid markers in urine ( F ) and serum ( G ).

Article Snippet: We performed real time polymerase chain reaction (PCR) analysis for ERβ assay (ref. NM_012754.1, 204 bp, 60°C, Servicebio: forward primer: 5′- CTGGGTGATTGCGAAGAGTGG -3′ and reverse primer: 5′- GAGGACTTGTACCCTCGAAG CG -3′) ( , ).

Techniques: Control, Real-time Polymerase Chain Reaction

Journal: Aging (Albany NY)

Article Title: ER-depletion lowering the 'hypothalamus-uterus-kidney' axis functions by perturbing the renal ERβ/Ptgds signalling pathway

doi: 10.18632/aging.102401

Figure Lengend Snippet: ER-depletion reduce HUK functions attribute to ERβ/Ptgds signalling pathway disturbance. Immunofluorescence (IF) analysis including the staining images ( A – C ) and AOD calculation data ( D ) in the left panel shows the double staining of ERβ (red) and Ptgds (green) from kidney ( A ), uterine ( B ), and hypothalamic ( C ) among control, OVX, and E2+OVX rats. Scale bar, 50 μM. The AOD ratio indicates the ratio of optical density (IOD) and values to staining area (AREA). Western blot (WB) analysis including the gel images ( E – F ) and protein loading data ( H ) in the middle panel present the ERβ and Ptgds proteins expression from kidney ( E ), uterine ( F ), and hypothalamic ( G ) among control, OVX, and E2+OVX rats. n=3, mean ± s.e.m. Real time PCR analysis of the transcription levels of ERβ and Ptgds expression various among control, OVX and OVX+E2 rats along ‘hypothalamus-uterus-kidney axis’ in the right panel ( I – K ). n=3, mean ± s.e.m., NS, not significant. Morris water maze test including location test and spatial learning test for control, OVX, and E2+OVX rats. As well as ( L ) escape latency duration, swimming length to the escape platform, number of crossings escape platform position, and ( M ) the images of total movement towards to the target for control, OVX, and E2+OVX rats. n=6, mean ± s.d., *p < 0.05, **p < 0.005, ***p < 0.0005 versus control rats; #p < 0.05, ##p < 0.005, ###p < 0.0005 versus control rats, NS, not significant.

Article Snippet: We performed real time polymerase chain reaction (PCR) analysis for ERβ assay (ref. NM_012754.1, 204 bp, 60°C, Servicebio: forward primer: 5′- CTGGGTGATTGCGAAGAGTGG -3′ and reverse primer: 5′- GAGGACTTGTACCCTCGAAG CG -3′) ( , ).

Techniques: Immunofluorescence, Staining, Double Staining, Control, Western Blot, Expressing, Real-time Polymerase Chain Reaction